Skip to main content

Table 1 Primers and probes used for pathogen detection in acute respiratory infections

From: Surveillance for respiratory infectious diseases caused by 6 common viruses in a recruit training site in the Northern region of China

Pathogen Name of primer Sequence (5′-3′)
Influenza A virus QFluA-F GAC CRA TCC TGT CAC CTC TGA C
QFluA-R GGG CAT TYT GGA CAA AKC GTC TAC G
QFLuA-Probe FAM- TGC AGT CCT CGC TCA CTG GGC ACG –BHQ1
Influenza B virus QFluB-F TCC TCA ACT CAC TCT TCG AGC G
QFluB-R CGG TGC TCT TGA CCA AAT TGG
QFLuB-Probe FAM- CCA ATT CGA GCA GCT GAA ACT GCG GTG -BHQ1
Influenza A
seasonal H1
QH1F AAC ATG TTA CCC AGG GCA TTT CGC
QH1R GTG GTT GGG CCA TGA GCT TTC TTT
QH1-Probe FAM-GAG GAA CTG AGG GAG CAA TTG AGT TCA G-BHQ1
Influenza A
seasonal H3
QH3F ACC CTC AGT GTG ATG GCT TCC AAA
QH3R TAA GGG AGG CAT AAT CCG GCA CAT
QH3-Probe FAM-ACG CAG CAA AGC CTA CAG CAA CTG T-BHQ1
Human adenovirus group B qHAdV-UniF TTTGAGGTYGAYCCCATGGA
qHAdV-UniR AGAASGGTGTRCGCAGGTA
qHAdV-UniProbe FAM-ACCACGTCGAARACTTCGAA-BHQ1
Human adenovirus type 3 qHAdV3-F GGGAGACAATATTACTAAAGAAGGTTTGC
qHAdV3-R CAACTTGAGGCTCTGGCTGATA
qHAdV3-Probe FAM-CACTAC“T*”GAAGGAGAAGAAAAGCCCATTTATGCC
Human adenovirus type 4 qHAdV4-F AAGCCAACCTGTGGAGKAACT
qHAdV4-R TGTTGGCCGGTGTGTATTTG
qHAdV4-Probe FAM-CTSTATGCCAATGTTGCCCTCTATTTGCCT-BHQ1
Human adenovirus type 7 qHAdV7-F GAGGAGCCAGATATTGATATGGAATT
qHAdV7-R AATTGACATTTTCCGTGTAAAGCA
qHAdV7-Probe FAM-AAGCTGCTGACGCTTTTTCGCCTGA-BHQ1
Human adenovirus type 11/55 qHAdV55-F CGGAGCAGCCAAATCAGAA
qHAdV55-R CATGAGTGTCTGGAGTTTCCAAAT
qHAdV55-Probe FAM-TGCGGCATCACAGAAAACAAACTTAAGTC-BHQ1
Human adenovirus type 14 qHAdV14-F GAAAATCATGGTGTGGAAGATGAA
qHAdV14-R CAAGCTTGGTCTCCATTTAACTGA
qHAdV14-Probe FAM-ACGGCATCGGTCCGCGAACA-BHQ1
Internal reference QRnaseP-F AGA TTT GGA CCT GCG AGC G
QRnaseP-R GAGCGGCTGTCTCCACAAGT
QRnaseP-P FAM-TTCTGACCTGAAGGCTCTGCGCG-BHQ1